The future of the molecular diagnostics of infectious diseases will undoubtedly be focused on a marked increase in the amount of information detected with remarkably simplified, rapid platforms that will need complex software analysis to resolve the data for use in clinical decision-making.
Big Data Analysis Suggests COVID Vaccination Increases Excess Mortality Of ...
MOLECULAR TOOLS IN DIAGNOSIS AND CHARACTERIZATION OF INFECTIOUS DISEASES
1. MOLECULAR TOOLS IN DIAGNOSIS
AND CHARACTERIZATION OF
INFECTIOUS DISEASES
Tawheed Ahmad Shafi
2. Introduction
• Since the advent of the PCR, numerous applications
in infectious diseases diagnostics have been
developed
• Several applications have been incorporated in the
routine diagonostic labs with a more user-friendly,
cost-effective, and accurate profile.
• Realtime PCR allowed this transition of the scientific
technology from basic research and reference center
testing into the mainstream clinical laboratories with
the ability to rapidly detect organisms such as group
B Streptococcus (GBS) and influenza virus
3. • Nucleic acid testing can be separated into amplified and
nonamplified methods.
• Nonamplified methods consist of DNA-labeled or RNA-labeled
probes that bind to the target nucleic acid and generate a signal
from the attached reporter molecule.
• Target amplification allows the use of multiple different types of
postamplification technologies to further characterize the
amplified targets of organism nucleic acids.
• A variety of nucleic acid methods are currently utilized for
detection/identification of organisms and their virulence
factors/resistance determinants.
4. History OF PCR
Great mind behind this PCR :Kary Banks Mullis
Developed PCR in 1985 and was awarded nobel prize in
1993.
PCR machine otherwise called Thermocycler.
• 1983—Kary Mullis, a scientist working for the Cetus
Corporation was driving along US Route 101 in northern
California when he came up with the idea for the
polymerase chain reaction.
• 1985—the polymerase chain reaction was introduced to the
scientific community at a conference in October. Cetus
rewarded Kary Mullis with a $10,000 bonus for his
invention
• Later, during a corporate reorganization, Cetus sold the
patent for the PCR process to a pharmaceutical company
Hoffmann-LaRoche for $300 million.
5. PCR a Revolution in Science
amplify a single or few copies of a piece of DNA,
generating millions or more copies of a
particular DNA sequence.
The method relies on, cycles of repeated
heating and cooling of the reaction for DNA
melting and enzymatic replication of the DNA.
Almost all PCR applications employ a heat-stable
DNA polymerase, such as Taq
polymerase, an enzyme originally isolated from
the bacterium Thermus aquaticus.
6.
7. PCR Reagents
• 1X Buffer
– 10mM Tris-HCl, 50mM KCl
• MgCl2
– 1mM - 4mM (1.5mM)
• dNTPs
– 200μM
• Primers
– 100nM-1μM, 200nm (or less) for real
time analysis
• DNA polymerase
– Taq DNA polymerase is thermostable
– 1-4 Units (1 unit)
• DNA
– 10pg-1μg (20ng)
8. Typical PCR Temps/Times
STEPS TEMPERATURE TIME
Initial denaturation 90o – 95o C 1 – 3 min
Denature 90o – 95o C 0.5 – 1 min
Primer annealing 45o – 65o C 0.5 – 1 min
Primer extension 70o – 75o C 0.5 – 2 min
Final extension 70o – 75o C 0.5 – 10 min
Stop reaction 4o C or 10 mM
EDTA
hold
9.
10.
11. Variations of the PCR
• Colony PCR
• Nested PCR
• Multiplex PCR
• Hot Start PCR
• Inverse PCR
• Asymmetric PCR
• Long PCR
• Reverse Transcriptase PCR
• Real time PCR
• Touchdown PCR
12. Colony PCR: the screening of bacterial (E.Coli) or yeast
clones for correct ligation or plasmid products.
Nested PCR: Involves two consecutive PCR reactions of 25
cycles. The first PCR uses primers external to the sequence of
interest. The second PCR uses the product of the first PCR in
conjunction with one or more nested primers to amplify the
sequence within the region flanked by the initial set of primers.
Multiplex PCR: is a variant of PCR which enabls
simultaneous amplification of many targets of interest in one
reaction by using more than one pair of primers.
Hot start PCR: This is a technique that reduces non-specific
amplification during the initial set up stages of the PCR. The
technique may be performed manually by heating the reaction
components to the melting temperature (e.g., 95°C) before
adding the polymerase
13. Long PCR: Used to amplify DNA over the entire length up to 25kb of
genomic DNA segments cloned.
Inverse PCR: Used to amplify DNA of unknown sequence that is adjacent
to known DNA sequence.
Quantitative PCR: Product amplification w r t time, which is compared
with a standard DNA.
Asymmetric PCR: preferentially amplifies one DNA strand in a double-stranded
DNA template. It is used in sequencing and hybridization probing
where amplification of only one of the two complementary strands is
required.
Reverse Transcriptase PCR- First step of RT-PCR - "first strand
reaction“-Synthesis of cDNA using oligo dT primers (37°C) 1 hr.“Second
strand reaction“-Digestion of cDNA:RNA hybrid. Allows the detection of
even rare or low copy mRNA sequences by amplifying its complementary
DNA.
14. Touchdown PCR (Step-down PCR):
a variant of PCR that aims to reduce nonspecific background by
gradually lowering the annealing temperature as PCR cycling progresses.
The annealing temperature at the initial cycles is usually a few degrees
(3-5 °C) above the Tm of the primers used,
while at the later cycles, it is a few degrees (3-5 °C) below the primer Tm.
The higher temperatures give greater specificity for primer binding, and
the lower temperatures permit more efficient amplification from the
specific products formed during the initial cycles
15. Applications of PCR Methods
• Medical Diagnostics
1) Diagnosis and characterisation of Infectious
diseases:
- Detect presence of viral pathogens
- Detect presence of pathogenic bacteria
2) Diagnosis and characterisation of genetic
diseases
3) Diagnosis and characterisation of Neoplasia
• Forensics
1) Identify criminal suspects
2) Paternity cases
16. Advances on PCR Methods
Real Time Assays
called “real-time PCR” because it allows to view the
increase in the amount of DNA as it is amplified.
The Real Time assays are proving to better technologies
Rapid
Quantitative measurement
Lower contamination rate
Higher sensitivity
Higher specificity
Easy standardization
17.
18. Real Time Reporters
• All real time PCR systems rely upon the
detection and quantization of fluorescent
reporter, the signal of which increases in direct
proportion of the amount of PCR product in a
reaction.
REAL TIME PCR Cyber Green
• The simplest and economical reporter is the
double strand DNA specific dye SYBR Green
• Called as Molecular Probe.
19. How SYBR Green works
• SYBR green binds
to double
stranded DNA and
upon excitation
emits light
• Thus as PCR
product
accumulates the
fluoresce
increases
20. Advantages
• Inexpensive
• Easy to Use
• Sensitive
Disadvantages
• SYBR green will bind to any double stranded
DNA in a reaction, may result in an
overestimation of the target concentration
21. Other Emerging Alternatives
• Two most popular alternatives to SYBR green are
TaqMan and Molecular Beacons
• Both technologies depend on hybridization probes
relying on fluorescence resonance energy transfer
(FRET) and quantization
22. Molecular Beacons
• Molecular Beacons
• Uses FRET-Fluorescence Resonance
Energy Transfer
• Uses two sequence specific
Oligonucleotide labelled with
fluorescent dyes
• Molecular beacons are designed to
adopt a hairpin structure while free in
solution, brining the fluorescent dye
and quencher in close proximity. When
a molecular beacon hybridizes to a
target the fluorescent dye emits light
upon irradiation, and rebind to target in
every cycle for signal measurement.
23. Documentation of Amplification
• The light emitted from
the dye in the excited
state is received by a
computer and shown
on a graph display,
such as this, showing
PCR cycles on the X-axis
and a logarithmic
indication of intensity
on the Y-axis.
24. Applications
• Some of the common real-time PCR assays that are
available include the tests for group A/B streptococcus,
methicillin-resistant Staphylococcus aureus (MRSA) and
influenza virus.
• There are numerous laboratory-developed realtime PCR
tests, including assays for poorly cultivatable or atypical
organisms (Bordetella pertussis, Legionella pneumophila,
Mycoplasma pneumoniae, Chlamydia pneumophila), and
the herpes viruses
• Recent development of assays for Zygomycetes,
Aspergillus, Candida sp., Pneumocystis jiroveci, and
Coccidiodes show promise for addressing some of the
common problems of analysis for these pathogens
25. Loop Mediated Isothermal Amplification
(LAMP)
• Loop mediated isothermal amplification is a
simple, rapid, specific and cost effective nucleic
acid amplification method.
• The amplification proceeds at a constant
temperature using strand displacement reaction.
• Amplification and detection of gene can be
completed in a single step, by incubating the
mixture of samples, primers DNA polymerase and
substrates at a constant temperature of 630c.
26. LAMP in Clinical Diagnosis
• LAMP technology proving to be ideal in detection of DNA or
RNA of the pathogenic organisms
• Proving to be highly efficient in diagnosis of Viral and Bacterial
infections
• LAMP is capable of detecting the presence of pathogenic
agents earlier than PCR
• A one step single tube real time accelerated reverse
transcription loop mediated isothermal amplification (RT-LAMP)
assays for rapid detection of some recently emerged
viral pathogen eg West Nile, Dengue, Japanese encephalitis
H5N1- highly pathogenic avian influenza.
27. Advantages of LAMP
• LAMP does not require an expensive
thermocycler
• Amplification specificity is extremely high as
LAMP requires 4/6 oligonucleotide primers
• Detection limit : LAMP ≥ PCR
• Detection time : LAMP < PCR
• Visualization of DNA products by LAMP:
(a) Eye – turbidity, colour change
(b) Real Time Turbidimeter
(C) Electrophoresis
28. PCR is susceptible to hemoglobin, Ig and
Heparin
LAMP resists contamination of above
mentioned materials
LAMP can amplify parasite DNA from fresh
infected blood
LAMP can be done by using rather crude DNA
extracted by simple methods
29. Hybridisation
• Nucleic acid hybridization as a technique involves using a
labeled nucleic acid probe, to bind with the target nucleic acids
• A probe labeled with detectable tracer is the prerequisite for
determining a specific DNA sequence or gene in a sample or
genomic DNA by nucleic acid hybridization.
• The target nucleic acids to be analyzed are usually denatured,
and then mixed with the labeled probe in the hybridization
system.
30. DNA from source “X”
CTGATGGTCATGAGCTGTCCGATCGATCAT
• The probe will bind to the
segment of nucleic acid with
complementary sequence
under proper conditions.
• The hybridization can be
identified by the detection of
the tracer labeling the probe.
• Thus the existence or the
expression of specific gene
can be determined.
ACAGGCTAGCTAGTA
ACAGGCTAGCTAGTA
Hybridization
ACAGGCTAGCTAGTA
nucleic acid probe
31. Preparation And Labeling Of Nucleic Acid
Probes may be
• single-stranded or
• double-stranded molecules
working probe must be single-stranded molecules.
The probes used in hybridization include
• oligonucleotide(15-50 nucleotides)
• genomic DNA fragment
• cDNA fragment and
• RNA.
32. Preparation And Labeling Of Nucleic Acid
• Probe is usually labeled with a detectable tracer, which is
either isotopic or non-isotopic. The purified
oligonucleotide is labeled in vitro by using a suitable
enzyme to add the labeled nucleotide to the end of the
oligonucleotide.
• The labels in common use include radioactive (32P and 35S)
and nonradioactive (digoxigenin, biotin, fluorescein)
substances which are used to label dNTP.
• After hybridization, the location and the quantity of the
hybrid molecules can be determined.
33. Hybridization Of Nucleic Acids
(Southern blot hybridization)
• In Southern blot hybridization, the target DNA is digested
with restriction endonucleases
• Following electrophoresis, the sample DNA fragments are
denatured in strong alkali, such as NaOH.
• The denatured DNA fragments are transferred to a
nitrocellulose or nylon membrane and become immobilized
on the membrane.
• The immobilized single-stranded target DNA sequences are
allowed to interact with labeled single-stranded probe DNA.
• The probe will bind only to complementary DNA sequences
in the target DNA to form a target-probe heteroduplex.
34. Southern blot hybridization detects target DNA fragments that
have been size-fractionated by gel electrophoresis
35. Widely applied in researches since its invention.
• Identification DNA from pathogenic
microorganism
• For analysis of gene expression
• Screening of recombinant plasmids
• Analysis of gene mutation
36. Typing
The process of differentiating strains based on their
phenotypic and genotypic differences is known as 'typing'.
These typing methods are useful in:
hospital infection control
epidemiological studies, and
understanding the pathogenesis of infection.
In hospital settings they may be used to:
determine whether a set of isolates obtained from one
patient represents a single infecting strain or multiple
contaminants.
determine whether a series of isolates obtained over time
represents relapse of an infection due to single strain or
separate episodes of disease due to different strains.
37. Criteria for evaluating typing systems
Typeability Capacity to produce clearly interpretable results
with most strains of the bacterial species
Reproducibility Capacity to repeatedly obtain the same typing
profile result with the same bacterial strain
Discriminatory
power
Ability to produce results that clearly allow
differentiation between unrelated strains of the
same bacterial species
Practicality
(ease of
performance &
interpretation)
Method should be versatile, relatively rapid,
inexpensive, technically simple and provide
readily interpretable results
38. Molecular Typing Techniques
Restriction analysis
Plasmid profiling
Restriction fragment length polymorphism (RFLP)
Ribotyping
Pulse Field Gel Electrophoresis (PFGE)
PCR amplification of particular genetic targets
Amplified fragment length polymorphism (AFLP)
RandomAmplified Polymorphic DNA (RAPD)
Repetitive element PCR (Rep-PCR)
Variable number of tandem repeat (VNTR) analysis and
Multiple locus VNTR analysis (MLVA)
Sequencing-based methods
Multilocus sequence typing (MLST)
Single nucleotide polymorphism (SNPs)
39. Random Amplified Polymorphic DNA
(RAPD) PCR
• Shortly after Kary Mullis invented the Polymerase Chain Reaction
(PCR) it was realized that short primers would bind to several
locations in a genome and thus could produce multiple fragments
• Williams et al. (1990) developed Random Amplified Polymorphic
DNA (RAPD) a technique using very short 10 base primers to
generate random fragments from template DNAs
• RAPD fragments can be separated and used as genetic markers or a
kind of DNA fingerprint
40. • The primers can be designed without the experimenter having any
genetic information for the organism being tested.
• More than 2000 different RAPD primers can be available
commercially.
• Genomic DNA normally has complimentary sequences to RAPD
primers at many locations.
• If two of these locations are close to each other (<2000-3000bp),
and the sequences are in opposite orientation, the amplification will
be established. This amplified region is said as a RAPD locus
• Normally, a few (3-20) loci can be amplified by one single RAPD
primer.
41. Template
DNA
RAPD
Primer binds to many locations on the template DNA
Only when primer binding sites are close and oriented in
opposite direction so the primers point toward each other will
amplification take place
42. Primers at the right
distance so amplification
will happen
100- 1500 bases
43. Primers point in the
same direction, so
amplification won’t
happen
Template
DNA
44. Primers too far apart so
amplification will not
happen
> 2,000- 3000 bases
46. Applications
• Has been largely carried out for variability analysis and
individual-specific genotyping, but is less popular due to
problems such as poor reproducibility, faint or fuzzy products,
and difficulty in scoring bands, which lead to inappropriate
inferences.
• RAPDs have been used for many purposes, ranging from studies
at the individual level (e.g. genetic identity) to studies involving
closely related species.
• RAPDs have also been applied in gene mapping studies to fill
gaps not covered by other markers
47. Limitations
• PCR based technique, therefore quality and concentration of
template DNA, concentrations of PCR components, and the
PCR cycling conditions may greatly influence the outcome.
• Thus, the RAPD technique is notoriously laboratory dependent
and needs carefully developed laboratory protocols to be
reproducible.
• Mismatches between the primer and the template may result in
the total absence of PCR product as well as in a merely
decreased amount of the product. Thus, the RAPD results can
be difficult to interpret.
48. Restriction Fragment Length
Polymorphism (RFLP)
• RFLP is a technique in which organisms may be
differentiated by analysis of patterns derived from
cleavage of their DNA.
• If two organisms differ in the distance between sites
of cleavage of particular Restriction Endonucleases,
the length of the fragments produced will differ when
the DNA is digested.
49. • The similarity of the patterns generated can be used to
differentiate species (and even strains) from one another.
• This technique is mainly based on the special class of
enzyme i.e. Restriction Endonucleases.
• The variability of restriction sites have their origin in the
DNA rearrangements, point mutations within the restriction
enzyme recognition site sequences, insertions or deletions
within the fragments, and unequal crossing over
50. A restriction fragment length polymorphism (RFLP)
The DNA molecule on the left has a polymorphic restriction
site (marked with the asterisk) that is not present in the molecule
on the right. The RFLP is revealed after treatment with the
restriction enzyme because one of the molecules is cut into four
fragments whereas the other is cut into three fragments.
51. Two methods for scoring an RFLP :
(A)RFLPs can be scored by Southern hybridization.
The DNA is digested with the appropriate restriction enzyme and
separated in an agarose gel. The smear of restriction fragments is
transferred to a nylon membrane and probed with a piece of
DNA that spans the polymorphic restriction site. If the site is
absent then a single restriction fragment is detected (lane 2); if
the site is present then two fragments are detected (lane 3).
52. (B) The RFLP can also be typed by PCR, using primers that anneal
either side of the polymorphic restriction site. After the PCR, the
products are treated with the appropriate restriction enzyme and
then analyzed by agarose gel electrophoresis. If the site is absent
then one band is seen on the agarose gel; if the site is present then
two bands are seen.
53. Applications:
• RFLPs can be applied in diversity and phylogenetic
studies ranging from individuals within populations or
species, to closely related species.
• RFLPs have been widely used in gene mapping studies
because of their high genomic abundance due to the ample
availability of different restriction enzymes and random
distribution throughout the genome
• RFLP markers were used for the first time in the
construction of genetic maps
54. Pulsed field gel electrophoresis (PFGE)
Conventional gel electrophoresis techniques:
separates DNA fragments from 100 to 200 bp to 50 kilobase pairs (kb)
only
DNA(>50kb) cant be separated by this method.
In 1982, Schwartz introduced the concept that DNA molecules larger
than 50 kb can be separated by using two alternating electric fields.
In conventional gels, the current is applied in a single direction (from top
to bottom).
But in PFGE, the direction of the current is altered at a regular interval.
55. Pulsed-field gel electrophoresis is based on the digestion of
bacterial DNA with restriction endonucleases that recognize
few sites along the chromosome, generating large DNA
fragments (30-800 Kb)
The basis for PFGE separation is the size-dependent time-associated
reorientation of DNA migration achieved by
periodic switching of the electric field in different directions.
The DNA fragments will form a distinctive pattern of bands
in the gel, which can be analyzed visually and electronically.
Bacterial isolates with identical or very similar band patterns
are more likely to be related genetically than bacterial isolates
with more divergent band patterns.
56.
57.
58.
59. Example of PFGE typing results (Staphylococcus aureus). Numbers and letters indicate
sample and strain assignment, respectively. Samples 1 through 8 originate from herd I,
samples 9 through 20 from herd II, and samples 21, 22, and 23 from herds III, IV, and
V, respectively.
60. Advantages of PFGE
PFGE has proved to be an efficient method for
genome size estimation
In PFGE DNA fragments obtained by using
endonucleases produce a discrete pattern of
bands useful for the fingerprinting and physical
mapping of the chromosome.
The PFGE technique is useful to establish the
degree of relatedness among different strains of
the same species.
61. Applications of PFGE
• PFGE is used for epidemiological studies of pathogenic organisms.
• PFGE is often employed to track pathogens, such as Salmonella, Shigella,
Escherichia coli (including O157), Campylobacter, and Listeria species
• PFGE has remarkable discriminatory power and reproducibility. It is
currently considered the strain typing method of choice for many
commonly encountered pathogens.
• PFGE has proven extremely powerful in the analysis of large DNA
molecules from a variety of sources including intact chromosomal DNAs
from fungi, parasitic protozoa and specifically fragmented genomes of
bacteria and mammal.
62. LIMITATIONS OF PFGE
• Time consuming (2-4 days)
• Requires a trained and skilled technician.
• Pattern results vary slightly between technicians.
• Don’t really know if bands of same size are same
pieces of DNA.
• Not applicable for all organisms.
• The choice of restriction enzyme may be important to
optimize the results
63. Conclusion
• The future of the molecular diagnostics of infectious
diseases will undoubtedly be focused on a marked
increase in the amount of information detected with
remarkably simplified, rapid platforms that will need
complex software analysis to resolve the data for use in
clinical decision-making.