1. NON-PCR-BASED MOLECULAR
METHODS OF BACTERIAL
CLASSIFICATION
Abdulrahman Mohammed
L-2012-V-21-D
School of Public Health & Zoonoses
2. INTRODUCTION
Taxonomy
– Science of biological classification
– Consists of three separate but interrelated parts
• classification – arrangement of organisms into
groups (taxa, sing.taxon)
• nomenclature – assignment of names to taxa
• identification – determination of taxon to
which an isolate belongs
3. INTRODUCTION
Methods in bacterial identification
1. Microscopic morphology - Gram Staining, shapes,
arrangements, motility
2. Macroscopic morphology – colony appearance, motility
3. Physiological / biochemical characteristics – aerobic,
anaerobic, photosynthetic, growth on selective media
4. Chemical analysis – e.g.peptides and lipids in cell
membranes
5. Phage Typing – which phage infects the bacterium
6. Serological analysis – what antibodies are produced against
the bacterium
7. Pathogenicity – what diseases does the bacterium cause.
8. Genetic and molecular analysis
4. 4
Genotypic Methods
• Genotypic methods involve examining the
genetic material of the organisms and has
revolutionized bacterial identification and
classification.
• Genotypic methods include PCR (RT-PCR, RAPD-PCR),
use of nucleic acid probes, RFLP and
plasmid fingerprinting.
• Increasingly genotypic techniques are becoming
the sole means of identifying many
microorganisms because of its speed and
accuracy.
5. Three general categories
• Restriction analysis
Plasmid profiling
Restriction enzyme analysis (REA)
Restriction fragment length polymorphism (RFLP)
Ribotyping
Pulse Field Gel Electrophoresis (PFGE)
• PCR amplification of particular genetic targets
Amplified fragment length polymorphism (AFLP)
Random Amplified Polymorphic DNA (RAPD)
Repetitive element PCR (Rep-PCR)
Variable number of tandem repeat (VNTR) analysis and multiple locus VNTR
analysis (MLVA)
• Sequencing-based methods
16S rDNA Sequence analysis
Whole genome sequencing
Multilocus sequence typing (MLST)
Single nucleotide polymorphism (SNPs)
6. Plasmid Profiling
• Plasmids are extrachromosomal, circular DNA molecules that are located
in the bacterial cytoplasm, that contain at least one origin of replication
• Isolation of plasmid DNA released under alkaline and high temperature
conditions that denature the chromosomal DNA
• Phenol:chloroform mixture to precipitate the plasmid DNA.
• Separated by gel electrophoresis, stained with a dye and viewed.
• Typically, supercoiled molecular size standards from E. coli R861 (NCTC
50192) and V517 (NCTC 50193), to determine the sizes of the isolated
plasmids
• The number and size of plasmid bands are analyzed to define the plasmid
profile for a particular isolate
7. BACTERIAL PLASMID
hsdhhjjkfdjfdfjfdjdjf
df
dfjkdjfkjdfkjdkjfkdfkj
jjfjfkjkjkkjkjkjkjkjkjkjk
jj
Schematic drawing of a bacterium with its plasmids
(1) Chromosomal DNA. (2) Plasmids
8. PLASMID
• Plasmid is autonomously replicating, extra-chromosomal circular
DNA molecules, distinct from the normal chromosomal DNAs and
non-essential for cell survival under nonselective conditions
• They usually occur in bacteria, sometimes in eukaryotic
organisms (e.g., the 2-um-ring in yeast S. cerevisiae).
• Sizes: 1 to over 400 kbp
• Copy numbers: 1 - hundreds in a single cell, or even thousands
of copies
• Every plasmid contains at least one DNA sequence that serves as
an origin of replication or ori (a starting point for DNA replication,
independently from the chromosomal DNA).
9. CONFORMATIONS OF PLASMID DNAs
Plasmid DNA may appear in the following five
conformations:
1) "Supercoiled" (or "Covalently Closed-Circular") DNA
is fully intact with both strands uncut
2) "Relaxed Circular" DNA is fully intact, but "relaxed"
(supercoils removed).
3) "Supercoiled Denatured" DNA. Both strands are
uncut but are not correctly paired, resulting in a
compacted plasmid form
4) "Nicked Open-Circular" DNA has one strand cut.
5) "Linearized" DNA has both strands cut at only one
site.
Super Coiled
SC
Relaxed region
Nicked DNAs
Linear DNA
10. Conformation cont….
•The relative electrophoretic mobility
(speed) of these DNA conformations in a
gel is as follows:
•Nicked Open Circular (slowest)
•Linear
•Relaxed Circular
•Supercoiled Denatured
•Supercoiled (fastest)
11. Plasmid Profiling
• Conformational changes in plasmids may affect the migration
properties of plasmids
• If copies of the same plasmid are in different conformation, they will
appear as multiple bands
• Strains can contain multiple plasmids of similar molecular weights,
which will co-migrate and appear as a single plasmid band on a gel.
• Digested with restriction enzymes such as HindIII, to generate a
restriction profile that can be used for plasmid typing
• Separated by agarose gel electrophoresis, and the banding profiles
can be compared to one another to distinguish the isolates
• Limitations :
Number of strains lack plasmids
Plasmids are transferable between bacterial strains
Can be detrimental in deciphering the genetic relatedness
13. • When only a single plasmid is present, restriction
endonucleases can be used to provide further evidence
of the similarities and differences between strains
• Restriction endonucleases, or restriction enzymes,
cleave DNA at specific sequences Plasmids and other
DNA molecules that have identical sequences produce
the same set of fragments after digestion with a
restriction endonuclease
• Restriction endonucleases are sensitive to many of the
chemicals used to isolate plasmid DNA, such as phenol,
detergent, ethanol, or chelators, so care must be taken
to remove these chemicals before digestion.
15. Restriction EEnnzzyymmee AAnnaallyyssiiss ((RREEAA))
• Extraction of plasmid or
chromosomal DNA
• Digestion of the DNA at particular
sites using specific restriction
enzymes
• Hundreds of DNA fragments of
various sizes (0.5-50Kb) separated
by gel electrophoresis
• LIMITATION: Complex profiles
with hundreds of unresolved or
overlapping bands
17. Restriction fragment length
polymorphism (RFLP)
• Restriction fragment length polymorphism uses restriction enzymes
(RE) to cut DNA at specific 4-6 bp recognition sites
• Sample DNA is cut (digested) with one or more RE's and resulting
fragments are separated according to molecular size using gel
electrophoresis
• Molecular size standards are used to estimate fragment size
• Ethidium bromide staining is used to reveal the fragments under UV
light
• Restriction fragment length polymorphism (RFLP) is most suited to
studies at the intraspecific level or among closely related taxa
18. Restriction fragment length
polymorphism (RFLP)
• When a frequent cutting restriction enzyme is used, the DNA
fingerprints are typically difficult to interpret
• Because there are often morebthan 100 fragments
• Comparison between the bacterial isolates
• 2 general approaches
1. Use of a rare cutting restriction enzyme and specialized
electrophoresis methods to separate the large DNA fragments
2. Transfer the large number of DNA fragments to membranes &
hybridize the DNA fragments with a labeled probe for specific
repetitive DNA fragments
19. Pulse Field Gel Electrophoresis
• Pulsed-field gel electrophoresis is based on the digestion of bacterial DNA with
restriction endonucleases that recognize few sites along the chromosome,
generating large DNA fragments (30-800 Kb) that cannot be effectively
separated by conventional electrophoresis.
• The basis for PFGE separation is the size-dependent time-associated
reorientation of DNA migration achieved by periodic switching of the electric
field in different directions.
• The DNA fragments will form a distinctive pattern of bands in the gel, which can
be analyzed visually and electronically.
• Bacterial isolates with identical or very similar band patterns are more likely to
be related genetically than bacterial isolates with more divergent band patterns.
20. ELECTROPHORESIS
• Widespread use in biological assays, and in the purification and separation of proteins
and nucleic acids.
• DNA fragments from 100 to 200 base pairs (bp) up to 50 kilobase pairs (kb) are routinely
separated by conventional gel electrophoresis techniques.
• Above 50 kb, because of the size of the molecules, the sieving action of the gel is lost,
and fragments run as a broad, unresolved band with anomalously high mobility.
PFGE:
• 1982: Schwartz et al. introduced the concept that DNA molecules larger than 50 kb can
be separated by using two alternating electric fields (i.e. PFGE).
• Pulsed field gel electrophoresis is a technique used for the separation of
large DNA molecules by applying to a gel matrix an electric field that periodically
changes direction.
24. Nucleic Acid Sequencing
• most powerful and direct method for
comparing genomes
• sequences of 16S (prokaryotes) and 18S
(eukaryotes) ribosomal RNA (rRNA) are used
most often in phylogenetic studies
• complete chromosomes can now be
sequenced and compared
25. 25
DNA Sequencing
• Computer analysis of 16S rRNA sequence has revealed
the presence of signature sequences, short
oligonucleotides unique to certain groups of organisms
and useful in their identification.
• rRNA sequence can be used to fine tune identity at the
species level e.g differentiating between
Mycobacterium and Legionella.
• 16s rRNA sequence can also be used to identify
microorganisms from a microbial community.
26. rDNA analysis
• The rRNA gene is the most conserved (least variable)
DNA in all cells. Portions of the rDNA sequence from
distantly related organisms are remarkably similar.
This means that sequences from distantly related
organisms can be precisely aligned, making the true
differences easy to measure. For this reason, genes
that encode the rRNA (rDNA) have been used
extensively to determine taxonomy, phylogeny
(evolutionary relationships), and to estimate rates of
species divergence among bacteria. Thus the
comparison of 16S rDNA sequence can show
evolutionary relatedness among microorganisms.
• Carl Woese, who proposed the three Domain system
of classification - Archaea, Bacteria, and Eucarya -
based on such sequence information, pioneered this
work
29. • Although the three domains of living
organisms were originally defined by
ribosomal RNA sequencing, subsequent
studies have shown that they differ in many
other ways
• Large public databases available for
comparison.
• Ribosomal Database Project currently
contains >1.5 million rRNA sequences.
30. Detailed phylogenetic tree of the major lineages
(phyla) of Bacteria based on 16S ribosomal RNA
sequence comparisons
31. RIBOSOMAL RNA
• To infer relationships that span the diversity of known
life, it is necessary to look at genes conserved through
the billions of years of evolutionary divergence.
• Examples of genes in this category are those that
define the ribosomal RNAs (rRNAs).
• In Bacteria, Archaea, Mitochondria, and Chloroplasts,
the small ribosomal subunit contains the 16S
• rRNA (where the S in 16S represents Svedberg units).
The large ribosomal subunit contains two rRNA species
(the 5S and 23S rRNAs).
32. • Most prokaryotes have three rRNAs, called the 5S, 16S
and 23S rRNA. Bacterial 16S, 23S, and 5S rRNA genes
are typically organized as a co-transcribed operon.
• There may be one or more copies of the operon
dispersed in the genome (for example, E coli has
seven).
• The Archaea contains either a single rDNA operon or
multiple copies of the operon
• rRNA targets were studied originally, most researchers
now target the corresponding ribosomal DNA (rDNA)
because DNA is more stable and easier to analyse
33. Types
• In prokaryotes: 23S, 5S,16S
• In eukaryotes: 28S, 5.8S, 5S, 18S
34. Ribosomal RNAs in Prokaryotes:
NAME SIZE (NUCLEOTIDES) LOCATION
5S 120 Large subunit of ribosome
16S 1500 Small subunit of ribosome
23S 2900 Large subunit of ribosome
35. • The 16s rDNA sequence has hypervariable regions, where
sequences have diverged over evolutionary time.
• Strongly conserved regions often flank these hypervariable
regions.
• Primers are designed to bind to conserved regions and amplify
variable regions.
• The DNA sequence of the16S rDNA gene has been determined
for an extremely large number of species. In fact, there is no
other gene that has been as well characterized in as many
species.
• Sequences from tens of thousands of clinical and environmental
isolates are available over the Internet through the National
Center for Biotechnology Information (www.ncbi.nlm.nih.gov)
and the Ribosomal Database Project (http://rdp.cme.msu.edu/).
• These sites also provide search algorithms to compare new
sequences to their database.
36. Why is the small subunit rRNA gene so useful ?
Conserved in parts – highly variable
in other parts. Thus it a very good
phylogenetic marker
VERY large database of sequences
Cell have many ribosomes which can
be targeted with probes (e.g. FISH,
&TRFLP) for community analysis
16S rRNA gene sequencing is now
the gold standard for community
analysis
37. Which hyper-variable regions to
sequence?
Region Position # b.p.
V1 69-99 30
V2 137-242 105
V3 338-533 195
V4 576-682 106
V5 822-879 57
V6 967-1046 79
V7 1117-1173 56
V8 1243-1294 51
V9 1435-1465 30
E.coli 16S SSU rRNA hyper-variable
regions
38. Some Databases
• National Center for Biotechnology Information
(www.ncbi.nlm.nih.gov)
• Ribosomal Database Project II
(http://rdp.cme.msu.edu/html/)
• Ribosomal Differentiation of Medical
Microorganisms (www.ridom.com)
• MicroSeq 16S 500 Library (Applied Biosystems)
• GenBank
• Mayo Database
39. Definitions
“A bacterium species is defined as ‘confidently identified by
16S rRNA gene sequencing’ if there is >3% difference
between the16S rRNA gene sequence of the species and
those of other medically important bacteria species. A
bacterium species is defined as ‘not confidently identified
by 16S rRNA gene sequencing’ if there is <2% difference
between the 16S rRNA gene sequence of the species and
that of one or more medically important aerobic Gram-positive
bacterium species. A bacterium species is defined
as ‘only doubtfully identified by 16S rRNA gene sequencing’
if there is 2–3 % difference between the 16S rRNA gene
sequence of the species and that of one or more medically
important aerobic Gram-positive bacterium species. (Woo
et al., 2009)
40. RFLP Fingerprinting Analysis
• RFLP = restriction fragment length polymorphism
• RFLP analysis involves cutting DNA into fragments using one
or a set of restriction enzymes.
• For chromosomal DNA the RFLP fragments are separated by
gel electrophoresis, transferred to a membrane, and probed
with a gene probe.
• One advantage of this fingerprinting technique is that all
bands are bright (from chromosomal DNA) because they are
detected by a gene probe. AP-PCR, ERIC-PCR, and REP-PCR all
have bands of variable brightness and also can have ghost
bands.
• For PCR products a simple fragment pattern can be
distinguised immediately on a gel. This is used to confirm the
PCR product or to distinguish between different isolates
based on restriction cutting of the 16S-rDNA sequence
“ribotyping”. Also developed into a diversity measurement
technique called “TRFLP”.
41. Southern Blot Hybridization
• SBH analysis is a method named after its developer, Southern, E, M.
(1979) that facilitates detection of a DNA fragment of interest among
hundreds of other fragments generated by REA
• Allows restriction digestion electrophoresis patterns to become
interpretable
• Restriction DNA fragments separated in agarose gel are transferred
(blotted) onto a piece of nitrocellulose or nylon membrane
• The membrane is then exposed to a DNA probe that has been labeled
with a molecule that facilitates visual detection of a selected target DNA
fragment
• The probe, which is a piece of single-stranded DNA, specifically binds
(hybridizes) to its complementary DNA sequence embedded in the
membrane under appropriate conditions
• When the SBH typing method uses ribosomal operon genes (rrn) found
among restriction-digested fragments in a membrane as the target, it is
called ribotyping
42. Southern Blotting
• Uses radioactive probes that bind to the specific DNA
segments
• Steps:
Soak gel in basic solution to separate DNA strands
Transfer DNA on to a nylon membrane (spacing of DNA is
maintained)
Incubate with radioactive probe for specific segment
Wash away unbound probe
Detect probes using x-ray film autoradiograph
43.
44. Nucleic Acid Hybridization
Nucleic Acid Hybridization
• measure of sequence homology
( molecular relatedness)
• common procedure for hybridisation:
– bind nonradioactive DNA to nitrocellulose filter
– incubate filter with radioactive single-stranded DNA
– The quantity of radioactivity bound to the filter reflects
the amount of hybridisation between the 2 DNA and thus
similarity of the 2 sequences.
45. …Nucleic Acid Hybridization
– measure amount of radioactive DNA attached to
filter.
– The degree of similarity is expressed as the % of
experimental DNA radioactivity retained on the
filter as compared to other sps. of the same genus
under the same conditions.
– Usually less than 5 % difference in melting point
( T m ) is considered as members of same sps.
46. …Nucleic Acid Hybridization
– measure amount of radioactive DNA attached to
filter.
– The degree of similarity is expressed as the % of
experimental DNA radioactivity retained on the
filter as compared to other sps. of the same genus
under the same conditions.
– Usually less than 5 % difference in melting point
( T m ) is considered as members of same sps.
47. 47
Nucleic acid probes
• Nucleic acid hybridization is one of the most
powerful tools available for microbe
identification.
• Hybridization detects for a specific DNA
sequence associated with an organism.
• The process uses a nucleic acid probe which is
specific for that particular organism.
• The target DNA (from the organism) is attached
to a solid matrix such as a nylon or
nitrocellulose membrane.
48. 48
Nucleic Acid Probes
• A single stranded probe is added and if there is
sequence complementality between the target and the
probe a positive hybridization signal will be detected.
• Hybridization is detected by a reporter molecule
(radioactive, fluorescent, chemiluminescent) which is
attached to the probe.
• Nucleic acid probes have been marketed for the
identification of many pathogens such as N.
gonorrhoeae.
49. 49
Two Component Probes
• Molecular probes are also finding wide spread use in the
food industry and food regulatory agencies.
• The pathogen DNA is attached to a “dipstick” to
hybridize to the pathogen DNA from the food.
• A two component probe is used (reporter and a capture
probe which are attached to each other).
• Following hybridization the dipstick with the capture
probe (usually poly dT to capture poly dA on the probe)
is inserted into the hybridization solution.
• It is traps the hybridized DNA for removal and
measurement.
50. Direct probe testing
• Hybridization – to come together through
complementary base-pairing.
– Can be used in identification.
– In colony hybridization the colony is treated to release the
nucleic acid which is then denatured to single strands.
• Labeled single-stranded DNA (a probe) unique to the organism
you are testing for is added and hybridization is allowed to occur.
• Unbound probe is washed away and the presence of bound probe
is determined by the presence of the label.
53. 53
Advantages of Nucleic Acid Probes
• Nucleic acid probes has many advantages over
immunological methods.
• Nucleic acid are more stable at high temperature, pH,
and in the presence of organic solvents and other
chemicals.
• This means that the specimen can be treated very
harshly to destroy interfering materials.
• Nucleic acid probes can be used to identify
microorganisms which are no longer alive.
• Furthermore nucleic acid probes are more specific than
antibodies.
54. Microarray Comparisons
• The availability of complete genome sequences has provided
another way to compare whole genomes based on
hybridization patterns generated from thousands of short
pieces of DNA (probes) of known sequence arranged on a
glass slide or nitrocellulose membrane. This arrangement of
DNA probes on a membrane is called microarray or “gene
chip”.
• Microarrays can also be made from DNA fragments
constructed from PCR products spotted onto a glass slide by
an automated arrayer.
55. Microarrays
Constructed using probes for a known nucleic acid sequence or for a series of targets, a
nucleic acid sequence whose abundance is being detected.
GeneChip microarrays consist of small DNA fragments (referred to also as probes),
chemically synthesized at specific locations on a coated quartz surface. By extracting,
amplifying, and labeling nucleic acids from experimental samples, and then hybridizing
those prepared samples to the array, the amount of label can be monitored at each
feature, enabling either the precise
identification of hundreds of thousands
of target sequence (DNA Analysis) or the
simultaneous relative quantitation of the
tens of thousands of different RNA
transcripts, representing gene activity
(Expression Analysis).
The intensity and color of each spot
provide information on the specific
gene from the tested sample.
56. …Nucleic Acid Sequencing
Comparative Analysis of 16S rRNA Sequences:
• Oligonucleotide signature sequences are short conserved
sequences specific for a phylogenetically defined group of
organisms
• either complete or, more often, specific rRNA fragments can
be compared
• when comparing rRNA sequences between 2 organisms, their
relatedness is represented by an association coefficient or Sab
value
• the higher the Sab value, the more closely related the organisms
57. Use of DNA Sequences to Determine
Species Identity
DNA sequences can also be used to determine species
strains in addition to genus
• It requires analysis of genes that evolve more quickly
than rRNA encoding genes
• Multilocus sequence typing (MLST), the sequencing
and comparison of 5 to 7 housekeeping genes
instead of single gene is done.
• This is to prevent misleading results from analysis of
one gene.
58. Sequence alignment is crucial for inferring how DNA
sites have changed.
Poor alignment
Implies that species “I” is
divergent from the others,
but this is not the case.
Good alignment.
Species “I” has probably
experienced a deletion event
at position #6 or #7.
59. 4. Estimate relationships based on extent of DNA similarity.
G
B
C
D
A
J
F
E
K
H
I
ATGTTGGCAGTCCGATGTAAGC
ATGTTGGCAGTCCGATGTAAGC
ATGTTGGCAGTCCGATGTAACC
ACGGTAGCAGTCTGATGTATCC
ACGGTAGCAGTCTGATGTATCC
ACGGTAGCAGTCTGATGTATCC
CTGCTGGTAGTCGTTTGTAACC
CTGCTGGTAGTCGTTTGTAACC
CTGCTGGCAGTCGGTTGTAACC
ATGCTGGCAGTCGGGTGTAACC
ATGGTGGCAGTCGGGTGTCACC
At variable DNA positions, related
groups will tend to share the
same nucleotide.
The sheer number of characters is
helpful to distinguish the
‘phylogenetic signal’ from noise.
Molecular phylogeny of taxa A-I.
Colored letters = different from top sequence (taxon G)
60. Example: Molecular
phylogenies have
revealed unexpected
features of bacterial
evolution.
For instance, an
endosymbiotic lifestyle has
evolved several times
independently.
Moran and Wernegreen (2000)
61. How does this organism fit into the world of available
sequence data?
ACAGATGTCTTGTAATCCGGCCGTTGGTGGCAT
AGGGAAAGGACATTTAGTGAAAGAAATTGATG
CGATGGGTGGATCGATGGCTTATGCTATCGATC
AATCAGGAATTCAATTTAGAGTACTTAATAGTA
GCAAAGGAGCTGCTGTTAGAGCAACACGTGCT
CAGGCAGATAAAATATTATATCGTCAAGCAATA
CGT
Sequence the
PCR product
“Blast” sequence
to Genbank
GENBANK = NIH genetic database with all publicly
available DNA sequences. As of 2004: > 44 billion
bp, and > 40 million sequences
Blast output:
Lists sequences
that are most
similar to yours
62. Comparison of Molecular Methods
Method Typing
capacity
Discriminatory
power
Reproducibility Ease of
use
Ease of
interpretation
Plasmid
analysis
Good Good Good High Good
PFGE High High High Moderate Good
moderate
Genomic
RFLP
High Good Good High Moderate–
poor
Ribotyping High High High Good High
PCR-RFLP Good Moderate Good High High
RAPD High High Poor High Good–high
AFLP High High Good Moderate High
Repetitive
Good Good High High High
elements
Sequencing High High High Moderate Good–high