Illumina Solutions for Reproductive and Genetic Health
•Download as PPTX, PDF•
2 likes•1,865 views
RGH ILLUMINA: Connecting the Continuum in Reproductive and Genetic Health, María Martínez-Fresno.
Recommended
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (15)
Similar to Illumina Solutions for Reproductive and Genetic Health
Similar to Illumina Solutions for Reproductive and Genetic Health (20)
More from TECNALIA Research & Innovation
More from TECNALIA Research & Innovation (20)
Recently uploaded
Recently uploaded (20)
Illumina Solutions for Reproductive and Genetic Health
- 1. © 2016 Illumina, Inc. All rights reserved. Illumina, 24sure, BaseSpace, BeadArray, BlueFish, BlueFuse, BlueGnome, cBot, CSPro, CytoChip, DesignStudio, Epicentre, ForenSeq, Genetic Energy, GenomeStudio, GoldenGate, HiScan, HiSeq, HiSeq X, Infinium, iScan, iSelect, MiniSeq, MiSeq, MiSeqDx, MiSeq FGx, NeoPrep, NextBio, Nextera, NextSeq, Powered by Illumina, SureMDA, TruGenome, TruSeq, TruSight, Understand Your Genome, UYG, VeraCode, verifi, VeriSeq, the pumpkin orange color, and the streaming bases design are trademarks of Illumina, Inc. and/or its affiliate(s) in the US and/or other countries. All other names, logos, and other trademarks are the property of their respective owners. Connecting the Continuum in Reproductive and Genetic Health Maria Martinez-Fresno IVF Market Development, RGH 15th Dec 2016
- 2. 2 Global Leader in Genomic Technologies The Illumina portfolio MiSeq Focused Power NextSeq 500 Flexible PowerRegulated Power MiSeqDx Production Power HiSeq 2500 Population Power HiSeq X Ten • 95% of the worlds sequencing data • First and only to deliver $1,000 genome with X Ten System
- 3. 3 We Serve Many Customers Jay Flatley President and CEO Human Health Genetics Infectious Disease Research Reproductive Health Forensics Consumer Cancer BioPharm Agriculture
- 4. 4 We deliver genomics solutions that empower people to have control over their reproductive destiny and healthcare management. To improve pregnancy success rates and birth outcomes. Reproductive and Genetic Health Our mission
- 5. 5 Reproductive and Genetic Health Portfolio Addressing the Continuum Solutions that Span the Spectrum of Reproductive and Genetic Health Preconception & Fertility Pregnancy Genetic Conditions
- 6. 6 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
- 7. 7 VeriSeq PGS • Next-generation PGS on MiSeq • All 24 chromosomes are screened for aneuploidy in a single test • For single cell or few cells from an embryo biopsy (day 3 and day 5) • From genomic DNA to results in 12 hours • <2.5 hours hands-on time • Data visualized in BlueFuse software
- 8. 8 Seamless Data Interpretation with BlueFuse
- 9. 9 Broader Dynamic Range than Arrays
- 10. 10 First PGS Publication on Illumina’s NGS Platform
- 11. 11 For Research Use Only. Not for use in diagnostic procedures. PGD Made Simple with Karyomap-12 Screening for Inherited Disorders Prior to Implantation
- 12. 12 Linkage-based PGD for Single Gene Disorders Child Affected Father (Carrier) Mother (Carrier) Embryo 1 Unaffected Embryo 2 Carrier Embryo 3 Carrier Embryo 4 Affected
- 13. 13 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
- 14. 14 For Research Use Only. Not for use in diagnostic procedures. verifi® Evolution
- 15. 15 For Research Use Only. Not for use in diagnostic procedures. illumina NIPT, from verifi® to Tech Transfer Test Menu: • Chromosomes 21,18,13 • Optional add-on • Sex chromosomes • Microdeletion panel • Trisomies 9 and 16 HiSeq® 16 Spl Manual (Tech Transfer) Test Menu: • Chromosomes 21,18,13 • Sex chromosomes NextSeq & OnSite Server
- 16. 16 Next-Generation Sequencing (NGS) Method of analysis for NIPT (Non-invasive prenatal testing) Sample Preparation & Next-Gen DNA Sequencing 2Isolation & Extraction of cfDNA 1
- 17. 17 Massively-Parallel Sequencing (MPS) Alignment of unique cfDNA sequences Data Analysis3 CGATTTAACT …ACCACGATTTAACTGGAGTAAAGACTTCCAGGTACCGATCTAGCCT… 20–30 million “counts” per sample GACTTCCAGG Count: AGGTACCGATCGATTTAACT Human Genome NOT TO SCALE
- 18. 18 Analysis of MPS Identifies Fetal Aneuploidy Through Counting Fetal cfDNA (20%) Maternal cfDNA Chromosomes: Aneuploidy Calling 4 NOT TO SCALE 1 10% more Chr21 cfDNA in T21 2 3 …… 21 Trisomy 21 VS
- 19. 19 For Research Use Only. Not for use in diagnostic procedures. verifi® Test in Average Risk Pregnancies
- 20. 20 For Research Use Only. Not for use in diagnostic procedures. Significant Improvement vs. Serum Screening
- 21. 21 For Research Use Only. Not for use in diagnostic procedures. VeriSeq NIPT Next Generation In-Lab NIPT 48/96 SAMPLE BATCHES ‘Ready To Go’ cfDNA isolation to Library Prep ~1 Day TAT cfDNA Isolation to Clinical Report ExtractionIsolation Library Prep Sequencing Analysis Clinical Report Paired- End NGS 2x36bp @ 8M PCR- Free Automated on One Hamilton Fetal Fraction 66% Less sequencing CE-IVD
- 22. 22 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
- 23. 23 CytoSNP-850K Exome Targeted Cytogenetics Array Exon-centric gene-level design Enriched coverage for 3,262 dosage sensitive genes Over 850,000 SNPs at 15x redundancy Detection sensitivity for mosaicism & absence of heterozygosity (AOH) Designed with input from international cytogenomics community, peer- reviewed literature, and databases – Cancer Cytogenetics Microarray Consortium (CCMC) – International Collaboration of Clinical Genomics (ICCG)
- 24. 24 TruSight One Comprehensive Clinical Exome Targeted Sequencing
- 25. 25 Perform both CFTR variant panel testing and CFTR gene sequencing on the same system MiSeqDx Instrument MiSeqDx Cystic Fibrosis 139-Variant Assay MiSeqDx Cystic Fibrosis Clinical Sequencing Assay 2-run20-run 6-run MiSeqDx Cystic Fibrosis System The First Complete NGS IVD Cystic Fibrosis Testing Solution
- 26. 26 Reproductive and Genetic Health Portfolio Addressing the Continuum Preconception & Fertility Pregnancy Genetic Conditions BlueFuse NextSeq MiSeqDx CFTR TruSight One24sure 24sure+ CLIA Test CytoSNP-850K VeriSeq PGS CytoSNP Karyomapping NextSeq NIPT IVD- in development
- 27. 27 Introducing the NextSeq 550 Sequencing and Array Scanning on a Single Platform The most successful, trusted sequencing and array technologies, available in one easy-to-use, affordable solution Seamless transition between arrays and sequencing Same flexible sequencing power as NextSeq 500
- 28. 28 NextSeq 550 Dual Functionality Enables Assay Expansion Across Genomics Applications Initial Support of Cytogenetic & Karyomapping Applications Same sequencing kits as NextSeq 500 Array adapter enables scanning • Infinium CytoSNP-12 • Infinium CytoSNP-850K • Infinium HumanKaryomap-12
- 29. Clinical Focus
- 30. Thank You
Editor's Notes
- QB# 1915 MLR approved 4.21.16
- Newborn Talking Points: - Shifting to the Newborn or Neonatal testing market The numbers are also compelling and the opportunity is large Sadly 1 in 200 children born has a hereditary genetic disease These range from hereditary hearing loss with over 5,000 effected children in the US last year To Sickle-cell anemia and CF that also impact 1000’s of children each year - 30-50% of neonatal deaths and - 20% of all infant deaths are due to a genetic disorder Genetics is also the cause of 50% of all mental retardation An early and accurate neonatal genetic diagnosis can make a huge difference In many cases something can be done Even when nothing can be done for the child the results can often help the parents Just knowing and having a diagnosis, having a name, a target, possibly hope, and definitely control in future reproductive choices Current neonatal testing is very broad with over 98% of newborns screened in the US but its also very limited regarding what is screened Genomic analysis of blood spots is poised to transform this area of medical practice The open platform MiSeq Dx and approved CF products is ideally suited to this market and we expect many new panels to be developed
- Siendo la unica empresa que a nivel clinic ofrece soluciones de secuenciacion masiva y arrays de SNPs
- Intro Talking Points: In January, 2014, the Reproductive and Genetic Health Business Unit was formed. Integrates the industry leading technology solutions of BlueGnome and Verinata with those of Illumina. Our mission is to provide innovative product solutions which span the spectrum of reproductive genetic health. Starting with conception and IVF, to genetic testing in pregnancy, and to newborn testing. Also encompasses clinical-grade genetic testing for general healthcare and carrier status. Provides our customers with the most comprehensive portfolio of genomics tools, truly supporting the continuum of needs in the reproductive biology and the clinical genetic testing markets These markets are substantial… There are over 200M pregnancies and 140M babies born every year The average age of pregnancy in the developed world is increasing, resulting in higher rates of miscarriage and fetal aneuploidy (chromosomal abnormalities). The number of IVF procedures is also growing rapidly. We are in the earliest of days of what will be one of genomics largest single areas of impact and Illumina’s technology is ideally suited to best serve these markets across the continuum. As a disclaimer, the products you’ll hear about in this presentation are for research use only, in development, or as noted are for in vitro diagnostic use.
- PGD Talking Points: Pre-implantation Genetic Diagnosis or PGD Is used to screen embryos in IVF when there is a family history of disease. Used when one parent is affected or both parents are carriers Currently PGD adoption rates are low as they rely on often custom multiplexed PCR primer kits, making it very slow and expensive but that’s about to change……… with the launch of Illumina’s Human Karyomapping product.
- 13, 18, 21 y CR sexuales, >1 M test hasta la fecha en verinata NIPT Unico con secuenciacion de genoma completo
- 13, 18, 21 y CR sexuales, >1 M test hasta la fecha en verinata NIPT Unico con secuenciacion de genoma completo
- PAIRED END NGS More information with less reads 2/3 reduction in sequencing Maintained quality Fragment size information
- Intro Talking Points: In January, 2014, the Reproductive and Genetic Health Business Unit was formed. Integrates the industry leading technology solutions of BlueGnome and Verinata with those of Illumina. Our mission is to provide innovative product solutions which span the spectrum of reproductive genetic health. Starting with conception and IVF, to genetic testing in pregnancy, and to newborn testing. Also encompasses clinical-grade genetic testing for general healthcare and carrier status. Provides our customers with the most comprehensive portfolio of genomics tools, truly supporting the continuum of needs in the reproductive biology and the clinical genetic testing markets These markets are substantial… There are over 200M pregnancies and 140M babies born every year The average age of pregnancy in the developed world is increasing, resulting in higher rates of miscarriage and fetal aneuploidy (chromosomal abnormalities). The number of IVF procedures is also growing rapidly. We are in the earliest of days of what will be one of genomics largest single areas of impact and Illumina’s technology is ideally suited to best serve these markets across the continuum. As a disclaimer, the products you’ll hear about in this presentation are for research use only, in development, or as noted are for in vitro diagnostic use.
- CNV tambien Intro Talking Points: In January, 2014, the Reproductive and Genetic Health Business Unit was formed. Integrates the industry leading technology solutions of BlueGnome and Verinata with those of Illumina. Our mission is to provide innovative product solutions which span the spectrum of reproductive genetic health. Starting with conception and IVF, to genetic testing in pregnancy, and to newborn testing. Also encompasses clinical-grade genetic testing for general healthcare and carrier status. Provides our customers with the most comprehensive portfolio of genomics tools, truly supporting the continuum of needs in the reproductive biology and the clinical genetic testing markets These markets are substantial… There are over 200M pregnancies and 140M babies born every year The average age of pregnancy in the developed world is increasing, resulting in higher rates of miscarriage and fetal aneuploidy (chromosomal abnormalities). The number of IVF procedures is also growing rapidly. We are in the earliest of days of what will be one of genomics largest single areas of impact and Illumina’s technology is ideally suited to best serve these markets across the continuum. As a disclaimer, the products you’ll hear about in this presentation are for research use only, in development, or as noted are for in vitro diagnostic use.
- Contains coverage of the genes defined by the International Collaboration of Clinical Genomics (ICCG) consortium. This panel represents the broadest extent of exon-level coverage for those genes associated with clinical phenotypes. Secuenciacion dirgida Opcion de filtado en el software
- Intro Talking Points: In January, 2014, the Reproductive and Genetic Health Business Unit was formed. Integrates the industry leading technology solutions of BlueGnome and Verinata with those of Illumina. Our mission is to provide innovative product solutions which span the spectrum of reproductive genetic health. Starting with conception and IVF, to genetic testing in pregnancy, and to newborn testing. Also encompasses clinical-grade genetic testing for general healthcare and carrier status. Provides our customers with the most comprehensive portfolio of genomics tools, truly supporting the continuum of needs in the reproductive biology and the clinical genetic testing markets These markets are substantial… There are over 200M pregnancies and 140M babies born every year The average age of pregnancy in the developed world is increasing, resulting in higher rates of miscarriage and fetal aneuploidy (chromosomal abnormalities). The number of IVF procedures is also growing rapidly. We are in the earliest of days of what will be one of genomics largest single areas of impact and Illumina’s technology is ideally suited to best serve these markets across the continuum. As a disclaimer, the products you’ll hear about in this presentation are for research use only, in development, or as noted are for in vitro diagnostic use.
- Wrap Up Talking Points: So in conclusion Illumina truly is unique and has the most powerful and complete portfolio of solutions to support the continuum of reproductive genomics and genetic health testing Thank you